Desafios, Biologia e Geologia 11.º ano



Baixar 147,01 Kb.
Pdf preview
Encontro07.02.2020
Tamanho147,01 Kb.

Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 1 de 11

 

 



 

 

 



 

 

Prova Escrita de Biologia e Geologia (Teste 3) 



11.º Ano de Escolaridade 

Duração da Prova: 90 minutos 

11 páginas 

 

 



 

 

Utilize apenas caneta ou esferográfica de tinta indelével, azul ou preta. 



Não é permitido o uso de corretor. Em caso de engano, deve riscar de forma inequívoca 

aquilo que pretende que não seja classificado. 

Escreva de forma legível a numeração dos grupos e dos itens, bem como as respetivas 

respostas. 

As respostas ilegíveis ou que não possam ser claramente identificadas são classificadas 

com zero pontos. 

Para cada item, apresente apenas uma resposta. Se escrever mais do que uma resposta 

a um mesmo item, apenas é classificada a resposta apresentada em primeiro lugar. 

Para responder aos itens de escolha múltipla, escreva, na folha de respostas: 

• o número do item; 

• a letra que identifica a única opção escolhida. 

Para responder aos itens de associação/correspondência, escreva, na folha de 

respostas: 

• o número do item; 

• a letra que identifica cada elemento da coluna A e o número que identifica o único 

elemento da coluna B que lhe corresponde. 

Para responder aos itens de ordenação, escreva, na folha de respostas: 

• o número do item; 

• a sequência de letras que identificam os elementos a ordenar. 

As cotações dos itens encontram-se no final do enunciado da prova. 

A ortografia dos textos e de outros documentos segue o Acordo Ortográfico de 1990. 

 

 



Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 2 de 11

 

 



 

 

 



 

 

 



 

 

 

Grupo I 

Experiência de Luria e Delbrück 

 

A  experiência  de  Luria  e  Delbrück,  também  conhecida  por  teste  de  flutuação,  foi  publicada  em  1943  e 



tornou-se  um  marco  no  estudo  dos  mecanismos  responsáveis  pelas  mutações  nos  organismos.  Em 

resultado, Max Delbrück e Salvador Luria ganharam o prémio Nobel da Medicina em 1969. 

Na década de 40 do século XX, pensava-se que as bactérias eram capazes de alterar o seu DNA em função 

das  condições  do  meio  ambiente,  mas  não  existiam  evidências  experimentais.  Luria  e  Delbrück 

implementaram uma experiência para testar se as mutações eram: 

 



pré-adaptativas – ocorreriam de forma aleatória, antes de as bactérias serem expostas ao agente 

de seleção; 

 

pós-adaptativas – resultariam de pressões resultantes do agente de seleção.  



 

Estas duas hipóteses encontram-se representadas na figura 1. 

 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 

 

 

Figura 1 – Hipóteses levantadas por Luria e Delbrück. 

 

Luria  e  Delbrück  inocularam  bactérias  da  espécie  Escherichia  coli  em  tubos  de  cultura  distintos.  Após  o 



crescimento,  transferiram  iguais  volumes  de  cultura  celular  para  placas  de  Petri  contendo  agar  (meio 

sólido) e repleto de bacteriófagos T1 (vírus que destroem as bactérias).  

Luria  e  Delbrück  esperavam  que  as  mutações  que  causam  resistência  aos  bacteriófagos  fossem  causadas 

pela  exposição  aos  mesmos,  originando  uma  distribuição  semelhante  entre  as  placas  de  Petri.  Os  seus 

resultados encontram-se representados na figura 2. 

 

 



 

 

 

 

 

 

 

 

Figura 2 – Resultados da experiência de Luria e Delbrück. Os pontos nas placas de Petri correspondem a 

colónias de bactérias que foram capazes de resistir aos bacteriófagos. 

Escola: ______________________________  11.º ano  Turma_____ Data ___/___/_____ 

Nome_________________________________________ N.º____ Classificação________ 



Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 3 de 11

 

 



 

 

 



 

 

Na  resposta  a  cada  um  dos  itens  de  1.  a  6.,  selecione  a  única  opção  que  permite  obter  uma  afirmação 



correta. 

 

1.



 

De acordo com os dados, no início da experiência Luria e Delbrück defendiam a hipótese ____, pois  

esperavam que as mutações ocorressem ____ da exposição ao agente de seleção.   

(A)

 

A (…) antes  



(B)

 

A (…) em resultado 



(C)

 

B (…) antes 



(D)

 

B (…) em resultado 

 

2.

 

Com base nos resultados da figura 2, é possível verificar que as mutações ocorreram de forma… 



(A)

 

…  aleatória  e  são  pré-adaptativas,  pois  ocorreram  antes  do  contacto  das  bactérias  com  os 

bacteriófagos. 

(B)

 

…  aleatória  e  são  pós-adaptativas,  pois  ocorreram  depois  do  contacto  das  bactérias  com  os 

bacteriófagos. 

(C)

 

… direcionada e são pré-adaptativas, pois ocorreram antes do contacto das bactérias com os 

bacteriófagos. 

(D)

 

…  direcionada  e  são  pós-adaptativas,  pois  ocorreram  depois  do  contacto  das  bactérias  com 

os bacteriófagos. 

 

3.



 

Relativamente à experiência de Luria e Delbrück, é possível afirmar que… 



(A)

 

… nos tubos 2 e 9 os meios de cultura não tinham nutrientes suficientes para a proliferação 

das bactérias, ao contrário do tubo 3. 

(B)

 

… as possíveis mutações nas bactérias do tubo 4 criaram resistência aos bacteriófagos. 



(C)

 

… nas bactérias as mutações genéticas surgem de forma independente do agente de seleção. 



(D)

 

… a seleção natural apenas pode ser aplicada em seres vivos complexos. 

 

4.

 

A bactéria Escherichia coli pode distinguir-se de uma célula vegetal… 



(A)

 

… por não ocorrer processamento do RNA mensageiro transcrito a partir do DNA. 



(B)

 

… pela quantidade de energia acumulada na molécula de ATP ser menor na bactéria. 



(C)

 

…  por  possuir  um  núcleo  menos  complexo  e  com  menor  quantidade  de  DNA 

comparativamente à segunda. 

(D)

 

… pela primeira apresentar a capacidade de acumular mutações no seu material genético. 

 

5.

 

De acordo com o sistema de classificação de Whittaker modificado, o critério que permite colocar a 

bactéria Escherichia coli inequivocamente no reino Monera é… 

(A)

 

… ser unicelular. 



(B)

 

… ser microconsumidor. 



(C)

 

… possuir parede celular. 



(D)

 

… ser constituída por uma célula procariótica. 

 

6.

 

Na designação da bactéria Escherichia coli, o termo… 



(A)

 

… Escherichia refere-se à ordem e coli ao restritivo específico. 



(B)

 

… Escherichia refere-se ao género e coli ao restritivo específico. 



(C)

 

… Escherichia refere-se à ordem e coli ao género. 



(D)

 

… Escherichia refere-se ao género e coli ao restritivo subespecífico. 

 

7.

 

Luria  e  Delbrück  deixaram  crescer  as  bactérias  e  depois  transferiram  iguais  volumes  de  cultura 

celular para placas de Petri. 

Refira a importância destes dois procedimentos experimentais. 

 

8.

 

Explique em que medida a experiência de Luria e Delbrück constituiu um forte argumento a favor 

das ideias de Darwin, em detrimento das ideias defendidas por Lamarck. 

 

9.



 

O  mecanismo  de  resistência  ao  bacteriófago  T1  está  relacionado  com  uma  mutação  que  ocorre  ao 

nível  de  um  gene  responsável  pela  síntese  de  uma  proteína  membranar  que  atua  como  recetor  do 

vírus e que permite a sua entrada na bactéria. 

Explique,  numa  perspetiva  neodarwinista,  o  aparecimento  de  novas  estirpes  de  bacteriófagos  que 

são capazes de infetar as bactérias resistentes. 

 


Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 4 de 11

 

 



 

 

 



 

 

Grupo II 



Evolução dos hominídeos 

 

A  evolução  da  nossa  espécie  é  ainda  pouco  conhecida.  Contudo,  a  partir  dos  dados  obtidos  através  do 



estudo  dos  fósseis  encontrados  por  todo  o  globo  e  de  dados  moleculares  é  possível  construir  árvores 

filogenéticas.  

Na figura 3 encontra-se uma possível relação filogenética que terá conduzido à evolução da nossa espécie. 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 Figura 3 – Possível evolução dos hominídeos. 

 

O  DNA  mitocondrial  de  humanos  modernos  foi  comparado  com  o  DNA  mitocondrial  de  chimpanzés  



(0  primata  filogeneticamente  mais  próximo)  e  com  amostras  recolhidas  de  vários  Neandertais,  um 

hominídeo que desapareceu da Europa há cerca de 28 000 anos, com resultados que podem ser avaliados 

na tabela I. 

 

 



 

Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 5 de 11

 

 



 

 

 



 

 

Tabela I – Comparação da sequência de DNA mitocondrial de diferentes organismos. A letra X indica que 

o nucleótido de DNA é igual ao da sequência humana. 

 

 



 

 

 



 

 

 



 

 

 



Na  resposta  a  cada  um  dos  itens  de  1.  a  5.,  selecione  a  única  opção  que  permite  obter  uma  afirmação 

correta. 

 

1.

 

A partir da árvore filogenética representada na figura 3, podemos concluir que… 



(A)

 

… os genéros Paranthropus e Homo têm origem em ancestrais diferentes. 



(B)

 

… a espécie mais próxima da nossa é o Homo erectus



(C)

 

… o género Homo teve origem no género Paranthropus



(D)

 

… a divergência do género Australopithecus  dos géneros Homo e Paranthropus ocorreu há 

menos de 3,5 milhões de anos.  

 

2.



 

A  explicação  mais  plausível  para  a  elevada  variabilidade  no  DNA  mitocondrial  das  populações 

humanas dispersas pelo continente africano é o facto de… 

(A)

 

… 0 homem moderno ter surgido em África e estar há mais tempo a evoluir neste continente.  



(B)

 

… o DNA mitocondrial ter uma taxa de mutação superior em África, quando comparado com 

outros continentes. 

(C)

 

…  0  homem  moderno  ter  surgido  em  África  e  estar  há  menos  tempo  a  evoluir  neste 

continente.  

(D)

 

…  a  seleção  natural  não  operar  no  DNA  mitocondrial  dos  organismos  que  habitam  o 

continente africano.  

 

3.



 

Paranthropus  aethiopicus,  Paranthropus  boisei  e  Homo  habilis  são  designações  de  três  espécies 

que pertencem à família Hominidae. Com base nesta nomenclatura, podemos concluir que… 



(A)

 

… P. aethiopicus e P. boisei partilham o mesmo restritivo específico. 



(B)

 

… P. boisei e H. habilis partilham a mesma ordem. 



(C)

 

… P. aethiopicus e H. habilis pertencem ao mesmo género. 



(D)

 

… as três espécies pertencem a ordens diferentes. 

 

4.

 

Os  hominídeos,  tal  como  os  restantes  mamíferos,  são  homeotérmicos,  ou  seja,  têm  temperatura 

corporal  ____  e  produzem  a  maioria  do  seu  calor  através  do  metabolismo,  sendo  por  isso 

designados ____. 



(A)

 

constante (…) ectotérmicos 



(B)

 

variável (…) endotérmicos 



(C)

 

constante (…) endotérmicos 



(D)

 

variável (…) exotérmico 

 

5.

 

Não constitui um argumento a favor da teoria endossimbiótica, o facto de… 



(A)

 

… o DNA mitocondrial ser circular e codificar todo o tRNA. 



(B)

 

…  os  complexos  proteicos  envolvidos  na  fosforilação  oxidativa  estarem  presentes  na  face 

interior da membrana interna da mitocôndria e na face interna da membrana plasmática das 

bactérias.  



(C)

 

…  alguns  organismos  eucariontes  sem  mitocôndrias  possuírem  genes  que  codificam 

proteínas semelhantes às proteínas mitocondriais. 

(D)

 

… os ribossomas mitocondriais serem pequenos e semelhantes aos das bactérias.  

 

6.

 

Mencione o primata do género Australopithecus ancestral dos hominídeos. 

 

Organismo 

Sequência de DNA mitocondrial analisado 

Humano moderno  

AATTCCCCGACTGCAATTCACGCACCATCCT 

Chimpanzé  

XXXXXXTXATTXXXXXACTGAAAXXXXGXXX 

Neandertal 1 

GGXCTTTTATTCXTCCCTGTAAGTATGCTXC 

Neandertal 2 

GGXXXXXXATTXATCCCCTGTAAXTATGCTT 

Neandertal 3 

XCXXXXXXATTXATCCCCTGTAAXTATGCTT 


Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 6 de 11

 

 



 

 

 



 

 

7.



 

Classifique como verdadeira (V) ou falsa (F) cada uma das afirmações seguintes tendo como base o 

estudo comparativo de DNA mitocondrial (Tabela I).   

A.

 

Existem mais diferenças entre a sequência de DNA mitocondrial do homem e do chimpanzé, 

do que do homem e do neandertal 1.  

B.

 

Existem mais diferenças entre as sequências de DNA  mitocondrial dos  neandertais 2 e 3, do 

que do homem moderno e do chimpanzé.  

C.

 

Existem menos diferenças entre as sequências de DNA mitocondrial dos neandertais 2 e 3, do 

que dos neandertais 1 e 2.  

D.

 

Com base na semelhança entre as sequências, os chimpanzés são mais próximos do neandertal 1 

do que dos humanos modernos.  

E.

 

Se  as  sequências  de  DNA  fossem  transcritas  e  traduzidas,  a  sequência  de  aminoácidos 

resultantes seria mais próxima entre os chimpanzés e o homem moderno do que entre este o 

neandertal 1. 



F.

 

Embora  pertençam  todos  à  mesma  espécie,  o  neandertal  2  e  o  neandertal  3  devem  partilhar 

um maior número de órgãos homólogos do que o neandertal 1 e o 2. 

G.

 

O  RNA  resultante  da  transcrição  do  DNA  mitocondrial  humano  analisado  terá  menos 

nucleótidos  de  uracilos  do  que  o  resultante  da  transcrição  do  DNA  mitocondrial  do 

chimpanzé. 



H.

 

Uma vez que as sequências de DNA analisadas não são iguais, estes dados contrariam a teoria 

da evolução a partir de um ancestral comum. 

 

8.



 

Faça  corresponder  a  cada  uma  das  letras  de  A  a  E,  que  correspondem  a  afirmações  relativas  à 

evolução da espécie humana, um dos números romanos da chave. Utilize cada letra apenas uma vez.  

 

Afirmações: 



A.

 

Numa população de hominídeos há características que são transmitidas à descendência e que 

resultaram  de  modificações  que  os  organismos  sofreram  para  responder  às  variações 

ambientais. 



B.

 

A espécie humana permanece imutável no tempo desde o momento da sua criação. 



C.

 

Numa  população  de  hominídeos  da  mesma  espécie,  os  indivíduos  que  apresentam 

características  mais  vantajosas  conseguem  adaptar-se  de  forma  mais  eficaz  às  variações  do 

meio. 


D.

 

Homo sapiens resulta de mecanismos evolutivos que atuaram ao longo do tempo. 



E.

 

Ao  nível  do  material  genético  ocorrem  mutações  que  podem  promover  o  aparecimento  de 

novos  genes  e,  consequentemente,  a  produção  de  fenótipos  que  permitem  uma  melhor 

adaptação ao meio. 

 

Chave: 

I.

 

Darwinismo 



II.

 

Fixismo 


III.

 

Fixismo e darwinismo 



IV.

 

Lamarckismo 



V.

 

Fixismo e neodarwinismo 



VI.

 

Lamarckismo, darwinismo e neodarwinismo 



VII.

 

Neodarwinismo 



VIII.

 

Lamarckismo e neodarwinismo 



 

 

 

 

 

 

 

 

 

 

 

Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 7 de 11

 

 



 

 

 



 

 

Grupo III 



Ciclo de vida de cogumelos 

 

Os fungos incluem um conjunto de organismos com ciclos de vida muito diversos, com formas de obtenção 

de  alimento  muito  próprias,  sendo  um  grupo  essencial  na  reciclagem  de  nutrientes  nas  cadeias 

alimentares.  

Embora  muitos  dos  aspetos  do  ciclo  de  vida  dos  fungos  sejam  ainda  desconhecidos,  alguns  organismos, 

como os cogumelos, possuem ciclos de vida já bem caracterizados.  

Os  cogumelos  têm  a  maioria  da  sua  massa  no  solo,  sob  a  forma  de  hifas,  formando  o  basidiocarpo.  Esta 

estrutura aérea é vulgarmente designada por cogumelo apenas numa fase restrita do seu ciclo de vida, que 

se encontra representado na figura 4. 

 

 



 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figura 4 

 

 

Na  resposta  a  cada  um  dos  itens  de  1.  a  5.,  selecione  a  única  opção  que  permite  obter  uma  afirmação 

correta. 

 

1.



 

Nos primeiros sistemas de classificação, o organismo representado na figura era incluído no reino 

____, e na classificação de Whittaker modificada foi incluído no reino ____. 

(A)

 

Plantae (…) Monera 



(B)

 

Plantae (…) Fungi 



(C)

 

Protista (…) Fungi 



(D)

 

Fungi (…) Protista 

 

 

 



Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 8 de 11

 

 



 

 

 



 

 

2.



 

No passado, alguns cientistas  consideravam que todos  os fungos tinham evoluído a partir de uma 

alga, que teria… 

(A)

 

… perdido os cloroplastos. 



(B)

 

… ganho os cloroplastos. 



(C)

 

… perdido as mitocôndrias. 



(D)

 

… ganho as mitocôndrias. 

  

3.

 

Os fungos são seres ____ quanto à fonte de carbono, quanto à organização celular ____. 



(A)

 

heterotróficos (…) são todos multicelulares 



(B)

 

heterotróficos (…) podem ser multicelulares ou unicelulares 



(C)

 

autotróficos (…) são todos multicelulares 



(D)

 

autotróficos (…) podem ser multicelulares ou unicelulares  

 

4.

 

Todos  os  fungos,  nos  quais  se  inclui  o  cogumelo  cujo  ciclo  está  representado  na  figura  4,  são 

organismos ____ e realizam ____. 

(A)

 

procariontes (…) digestão intracorporal 



(B)

 

procariontes (…) fotossíntese 



(C)

 

eucariontes (…) digestão extracorporal 



(D)

 

eucariontes (…) fotossíntese 

 

5.

 

Para que ocorra a replicação do DNA nos núcleos das células de fungos é necessário… 



(A)

 

… DNA polimerase e nucleótidos contendo ribose. 



(B)

 

… glicose, ATP e mRNA. 



(C)

 

… RNA ribossómico e aminoácidos. 



(D)

 

… DNA polimerase e nucleótidos contendo desoxirribose. 

 

6.

 

As afirmações seguintes são respeitantes ao ciclo de vida representado na figura 4. 

Utilize cada um dos termos da chave para avaliar cada uma das afirmações de A a H.  

 

Chave: 



I.

 

Afirmação apoiada pelos dados 



II.

 

Afirmação contrariada pelos dados 



III.

 

Afirmação sem relação com os dados 

 

Afirmações: 

A.

 

O basidiocarpo é uma estrutura cujas células são haplontes e possuem apenas um núcleo. 



B.

 

No  basidiocarpo,  após  a  união  dos  dois  núcleos,  ocorre  uma  divisão  que  não  mantém  o 

número de cromossomas, formando esporos. 

C.

 

Após a formação dos esporos, estes são espalhados no meio ambiente pela ação da água e do 

vento. 

D.

 

A germinação dos esporos depende da ocorrência de meioses sucessivas. 



E.

 

O  ciclo  de  vida  representado  na  figura  4  evidencia  apenas  mecanismos  de  reprodução 

assexuada, com predominância de uma fase haplonte. 

F.

 

O organismo representado possui órgãos sexuais especializados. 



G.

 

Imediatamente após a fusão das hifas de organismos diferentes, ocorre a fusão dos respetivos 

núcleos. 

H.

 

Os  fungos  obtêm  os  nutrientes  que  necessitam  por  absorção,  sendo  por  isso  designados  por 

microconsumidores. 

 

7.



 

Em  1928,  o  investigador  Alexander  Fleming  observou  que  esporos  libertados  por  fungos 

decompositores do pão e da fruta impediram o crescimento de bactérias. Desde 1941 que  se usa a 

penicilina  extraída  a  partir  dos  fungos  como  antibiótico,  no  tratamento  de  diversas  doenças 

causadas por bactérias. A penicilina interfere na síntese da parede das bactérias, cujo citoplasma é 

hipertónico relativamente ao meio. 



7.1.

 

Relacione a eficácia da penicilina enquanto antibiótico com o seu modo de atuação. 



7.2.

 

Explique  em  que  medida  a  produção  e  libertação  de  penicilina  pelos  fungos  confere  uma 

vantagem competitiva sobre as bactérias decompositoras vizinhas. 

 

 



 

Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 9 de 11

 

 



 

 

 



 

 

Grupo IV 



Sismologia 

 

Os  estudos  na  área  da  sismologia  são  essenciais  para  compreendermos  a  dinâmica  interna  do  nosso 

planeta e permitir prever a ocorrência do próximo grande sismo. 

Algumas  regiões  da  superfície  terrestre  possuem  maior  atividade  que  outras.  Por  exemplo,  na  zona  das 

ilhas  Aleutas,  cuja  localização  se  encontra  assinalada  na  figura  5,  desde  1990  até  ao  final  de  2014 

registaram-se 202 sismos com magnitude superior a 5. 

Com base no padrão dos sismos é possível concluir que nas ilhas Aleutas existe uma zona de subducção. 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

 



 

 

Fonte: USGS, National Earthquake Information Center 



 

Figura 4 – (A) Principais placas litosféricas, com indicação da localização das ilhas Aleutas.  

(B) Sismicidade histórica desde 1990 até 2014. 

 

 

 





Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 10 de 11

 

 



 

 

 



 

 

Na  resposta  a  cada  um  dos  itens  de  1.  a  5.,  selecione  a  única  opção  que  permite  obter  uma  afirmação 



correta. 

 

1.



 

A partir da distribuição dos sismos, é possível concluir que na fossa das Aleutas ocorre a subducção 

da placa ____ sob a placa ____. 

(A)

 

norte-americana (…) euro-asiática 



(B)

 

euro-asiática (…) norte-americana 



(C)

 

do pacífico (…) euro-asiática 



(D)

 

do pacífico (…) norte-americana 

 

2.

 

No contexto tectónico das ilhas Aleutas é expetável que, com o afastamento para norte da zona de 

subducção, o ____ dos sismos se torne mais ____.  

(A)

 

hipocentro (…) profundo 



(B)

 

hipocentro (…) superficial 



(C)

 

epicentro (…) profundo 



(D)

 

epicentro (…) superficial 

 

3.

 

Nas zonas de subducção o vulcanismo tende a ser do tipo ____, com emissão de lavas cujo teor em 

sílica as permite incluir no grupo das lavas com composição ____. 

(A)

 

explosivo (…) básica 



(B)

 

efusivo (…) básica 



(C)

 

explosivo (…) intermédia 



(D)

 

efusivo (…) intermédia 

 

4.

 

Em termos morfológicos, uma zona de subducção está habitualmente marcada por uma ____, e um 

rifte submarino está no centro de uma ____. 

(A)

 

fossa oceânica (…) plataforma continental 



(B)

 

fossa oceânica (…) dorsal médio oceânica 



(C)

 

plataforma continental (…) dorsal médio oceânica 



(D)

 

planície abissal (..) dorsal médio oceânica 

 

5.

 

Na figura 4B está representado um limite tectónico do tipo ____, em que ocorre ____ das placas 

litosféricas. 

(A)

 

convergente (…) destruição 



(B)

 

convergente (…) produção 



(C)

 

divergente (…) destruição 



(D)

 

divergente (…) produção 

 

6.

 

Num sismo de magnitude elevada que seja gerado na zona de subducção na região das Aleutas, não 

serão registadas  ondas sísmicas ____ por sismógrafos que  se encontrem a uma distância angular 

de, aproximadamente, ____ relativamente ao epicentro. 



(A)

 

P (…) 103º e 180º 



(B)

 

S (…) 103º e 180º 



(C)

 

P (…) 143º e 180º 



(D)

 

S (…) 43º e 180º 

 

7.

 

Ordene  as  letras  de  A  a  E  de  modo  a  reconstituir  a  sequência  cronológica  de  acontecimentos  que 

ocorrem na propagação de ondas sísmicas. 

A.

 

Chegada das ondas P ao epicentro. 



B.

 

Propagação de ondas superficiais a partir do epicentro. 



C.

 

Propagação de ondas S e P a partir do hipocentro. 



D.

 

Chegada  das  ondas  P  a  uma  estação  sismográfica  situada  3000  km  a  oeste  do  epicentro, 

seguida de ondas S. 

E.

 

Acumulação de energia nas rochas em profundidade, ao longo do tempo que antecede o sismo. 

 

8.

 

A  maioria  dos  tsunamis  são  gerados  em  ambientes  tectónicos  semelhantes  ao  das  ilhas  Aleutas. 

Relacione a formação dos tsunamis com a magnitude dos sismos e o ambiente tectónico em que se 

geram. 


 

 

 



Desafios, Biologia e Geologia 11.º ano 

© ASA, 2015 

Página 11 de 11

 

 



 

 

 



 

 

Prova Escrita de Biologia e Geologia (Teste 3) 



11.º Ano de Escolaridade 

 

 



 

COTAÇÕES 

 

GRUPO I 

1. ........................................................................................................................................  5 pontos 

2. ........................................................................................................................................  5 pontos 

3. ........................................................................................................................................  5 pontos 

4. ........................................................................................................................................  5 pontos 

5. ........................................................................................................................................  5 pontos 

6. ........................................................................................................................................   5 pontos 

7. ........................................................................................................................................  5 pontos 

8. ........................................................................................................................................ 10 pontos 

9. ........................................................................................................................................  10 pontos 

55 pontos 

GRUPO II 

1. ........................................................................................................................................  5 pontos 

2. ........................................................................................................................................  5 pontos 

3. ........................................................................................................................................  5 pontos 

4. ........................................................................................................................................  5 pontos 

5. ........................................................................................................................................  5 pontos 

6. ........................................................................................................................................  5 pontos 

7. ........................................................................................................................................  10 pontos 

8. ........................................................................................................................................ 10 pontos 

50 pontos 

GRUPO III 

1. ........................................................................................................................................  5 pontos 

2. ........................................................................................................................................  5 pontos 

3. ........................................................................................................................................  5 pontos 

4. ........................................................................................................................................  5 pontos 

5. ........................................................................................................................................  5 pontos 

6. ........................................................................................................................................ 10 pontos 

7.1 .......................................................................................................................................  5 pontos 

7.2 ...................................................................................................................................... 10 pontos 

50 pontos

  

GRUPO IV 

1. ........................................................................................................................................  5 pontos 

2. ........................................................................................................................................  5 pontos 

3. ........................................................................................................................................  5 pontos 

4. ........................................................................................................................................  5 pontos 

5. ........................................................................................................................................  5 pontos 

6. ........................................................................................................................................  5 pontos 

7. ........................................................................................................................................  5 pontos 

8. ........................................................................................................................................ 10 pontos 

45 pontos

  

 

 

TOTAL .............................. 200 pontos 


Compartilhe com seus amigos:


©bemvin.org 2019
enviar mensagem

    Página principal